Gene: [03q2/RHO] rhodopsin (visual pigment apoprotein); retinitis pigmentosa 4, (autosomal dominant; rhodopsin-related); congenital stationary night blindness 4; [RP4 RP5 CSNB4 ]

GEN

 The gene length is 6.7 kb. Exons: 5. Introns: 4. The 5'-UTL region of the cDNA is 95 bp and the 3'-UTL region is about 1.5 kb in length."

MOP

 [1] Rhodopsin is a visual pigment of the retina photoreceptors. It consists of an apoprotein, opsin, and a low-molecular chromophore, 11-cys-retinal (sometimes 11-cys-dehydroretinal), which are covalently bound with each other.
[2] The primary translation product, opsin, contains 348 amino acid residues."

HIS

 [1] It was originally assumed that the autosomal dominant retinitis pigmentosa (clinical genetic variants being not taken into account) is related to locus RP1, which was mapped to chromosome 1 on the basis of slight linkage with Rh antigen genes (Field-1982, Daiger-1987 and others). Afterwards it was demonstrated (Bradley-1989, Inglehearn-1990) that at least the infant form of RPD1 is not linked with any marker in the short arm of chromosome 1 within a 250 cM region, all the more with the Rh locus within its 50 cM vicinity. At the same time, the form RPD1 (RP1, according to MIM-90, or RP4, according to HGM-10.5) was found to be determined by the mutations of the gene for the main retinal photoreceptor protein, rhodopsin (Dryja-1990), which was previously mapped to chromosome 3q.
[2] More details on the early works on the RP mapping are reported by Daiger et al. in:

HET

 Five clinical genetic forms of retinitis pigmentosa that is not complicated with any other disturbances (as deafness in Usher syndrome, GEM:01q41/USH2A) are definitely described. Among them are: - two autosomal dominant forms (D1 form, with onset in childhood before 10 years, characterized by symptoms of night blindness and diffuse retina lesion, and D2 form, with onset in youth or after 20 years of age, characterized by a focal lesion of retina); - two X-linked forms: GEM:0Xp113/RP2 and GEM:0Xp211/RP3; - one autosomal recessive form (MIM:268000), which is not mapped yet. The MIM catalogue includes 3 other recessive RP forms as secondary markers."

MUT

 Dryja-1990 demonstrated that 11.5% patients with the infant form of RPD1 have a point mutation in 23d codon of the opsin gene: the C-->A transversion in the second position of the codon results in replacing Pro by His. Taking into consideration the pronounced conservativity of Pro in this position in all opsins, one can assume that its replacing disturbs substantially the apoprotein function and results in progression of the dominant form of retinitis."

POL

 [1] PCR amplification with oligonucleotide probes Mfd2L/Mfd2R gave the following 118-124-bp fragments: Mfd2L - cattaggatgcattcttctg and Mfd2R - gtcaggattgaactgggaac. --------------------------------------------------------- RFLP systems: ------------- RFLP name (Reference; Probe number): Const Bands in kb; Alleles in kb/(Popul Freq) --------------------------------------------------------------------
[1] A-RFLP (Weber-1989a/b; Probe [1]): A1= 0.124/(0.06); A2= 0.122/(0.11); A3= 0.120/(0.80); A4= 0.118/(0.02); AC dinucleotide repeat"

REF

 MUT,MOL,PAT "Berson EL &: Arch Ophthal, 109, 92-101, 1991
LOC,PAT,LIN "Bradley DG &: AJHG, 44, N4, 570-576, 1989
MUT,MOL,PAT "Dryja TP &: Nature Genet, 4, 280-283, 1993
MUT,MOL,PAT "Dryja TP &: Nature, 343, 364-366, 1990
MUT,MOL,PAT "Farrar GJ &: Hum Mol Genet, 1, 769-771, 1992
MUT,MOL,PAT "Farrar GJ &: Genomics, 11, 1170-1171, 1991
LIN,COM "Field LL &: J Med Genet, 19, 266-270, 1982
MUT,ASS,PAT "Fishman GA &: Arch Ophthal, 110, 646-653, 1992a
MUT,ASS,PAT "Fishman GA &: Arch Ophthal, 110, 1582-1588, 1992b
MUT,ASS,PAT "Fishman GA &: Arch Ophthal, 109, 1387-1393, 1991
MUT,MOL,PAT "Gal A &: Genomics, 11, 468-470, 1991
MUT,MOL,PAT "Heckenlively JR &: Arch Ophthal, 109, 84-91, 1991
LIN,COM "Heckenlively JR &: Ophthal Res, 14, 46-53, 1982
LIN,COM "Hussels-Maumenee &: AJHG, 27, 505-508, 1975
LOC,PAT,LIN "Inglehearn CF &: AJHG, 53, 536-537, 1993
LOC,PAT,LIN "Inglehearn CF &: AJHG, 50, 590-597, 1992a
MUT,MOL,PAT "Inglehearn CF &: Hum Mol Genet, 1, 41-45, 1992b
MUT,MOL,PAT "Inglehearn CF &: AJHG, 48, 26-30, 1991
LOC,PAT,LIN "Inglehearn CF &: J Med Genet, 27, 14-16, 1990
MUT,MOL,PAT "Keen TJ &: Genomics, 11, 199-205, 1991
MUT,MOL,PAT "Kranich H &: Hum Mol Genet, 2, 813-814, 1993
LOC,PAT,LIN "Kumar-Singh R &: AJHG, 52, 319-326, 1993
MUT,MOL,PAT "Macke JP &: AJHG, 53, 80-89, 1993
LOC,PAT,LIN "McWilliam P &: Genomics, 5, 619-622, 1989
GEN,MOP,EVO,LOC "Nathans J &: Science, 232, 193-202, 1986a
GEN,MOP,EVO,LOC "Nathans J &: Science, 232, 203-210, 1986b
CLO,GEN,SEQ,EXP "Nathans J, Hogness: PNAS, 81, (Aug), 4851-4855, 1984
LOC,PAT,LIN "Olsson JE &: Am J Med Genet, 35, 595-599, 1990
MUT,MOL,PAT "Rao VR &: Nature, 367, 639-642, 1994
MUT,ASS,PAT "Sheffield VC &: AJHG, 49, N4, 699-706, 1991
MUT,MOL,PAT "Sieving PA &: PNAS, 92, 880-884, 1995
MUT,ASS,PAT "Souied E &: Am J Ophthal, 121, 19-25, 1996
LOC,CYG,MOL "Sparkes RS &: Curr Eye Res, 5, 797-798, 1986a
LOC,CYG,MOL "Sparkes RS &: Invest Ophthal Vis Sci, 127, 1170-1172, 1986b
LIN,COM "Spence MA &: AJHG, 29, 397-404, 1977a
LIN,COM "Spence MA &: AJHG, 29, (corrections), 592, 1977b
MUT,ASS,PAT "Sullivan LJ &: Arch Ophthal, 111, 1512-1517, 1993
MUT,MOL,PAT "Sung C-H &: J Neurosci, 14, 5818-5833, 1994
MUT,MOL,PAT "Sung C-H &: JBC, 268, 26645-26649, 1993
MUT,MOL,PAT "Sung C-H &: PNAS, 88, 6481-6485, 1991
MUT,MOL,PAT "Vaithinathan R &: Genomics, 21, N2, 461-463, 1994
PRO,POL "Weber JL &: AJHG, 44, 388-396, 1989a
PRO,POL "Weber JL &: CCG, 51, (HGM10), 1103, 1989b

KEY

 eye, sign

CLA

 coding, basic

LOC

 03 q21.3-24

MIM

 MIM: 180380

SYN

 RP4 RP5 CSNB4

Ссылки: